Epoxide hydrolase (EPHX1) (NM_000120) Human 3' UTR Clone

CAT#: SC202753

3' UTR clone of epoxide hydrolase 1 microsomal (xenobiotic) (EPHX1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Epoxide hydrolase (EPHX1) (NM_000120) Human 3' UTR Clone
Vector pMirTarget
Synonyms EPHX; EPOX; HYL1; MEH
ACCN NM_000120
Insert Size 246 bp
Sequence Data
>SC202753 3’UTR clone of NM_000120
The sequence shown below is from the reference sequence of NM_000120. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGTTCCTGTCGGTGCTGGAGCGGCAATGACCCACCCCTCTCCCCCCGCCTGCCACCTCCCCCCACAAG
TGCCCTCCAGGCTTTTCTTGGGGAAGATACCCCTTTTCTGAGGAATGAGTTTGCCTCCGTCCCCTGCCC
ATGCTGGGAGCCCACGCTCACCCCCTCACCCCTCCAAGCTCACTCCCCAACCCCCAACTCCGTGTGGTA
AGCAACATGGCTTTGATGATAAACGACTTTACTCTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000120.4
Synonyms EPHX; EPOX; HYL1; MEH
Summary Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
Locus ID 2052
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...