PRMT1 (NM_198318) Human 3' UTR Clone

CAT#: SC202712

3' UTR clone of protein arginine methyltransferase 1 (PRMT1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PRMT1 (NM_198318) Human 3' UTR Clone
Vector pMirTarget
Synonyms ANM1; HCP1; HRMT1L2; IR1B4
ACCN NM_198318
Insert Size 232 bp
Sequence Data
>SC202712 3’UTR clone of NM_198318
The sequence shown below is from the reference sequence of NM_198318. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTGCTCCACCGACTACCGGATGCGCTGAGGCCCGGCTCTCCCGCCCTGCACGAGCCCAGGGGCTGAG
CGTTCCTAGGCGGTTTCGGGGCTCCCCCTTCCTCTCCCTCCCTCCCGCAGAAGGGGGTTTTAGGGGCCT
GGGCTGGGGGGATGGGGAGGGCACATCGTGACTGTGTTTTTCATAACTTATGTTTTTATATGGTTGCAT
TTACGCCAATAAATCCTCAGCTGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198318.5
Synonyms ANM1; HCP1; HRMT1L2; IR1B4
Summary This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Locus ID 3276
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...