Renin (REN) (NM_000537) Human 3' UTR Clone

CAT#: SC202699

3' UTR clone of renin (REN) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Renin (REN) (NM_000537) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADTKD4; HNFJ2; RTD
ACCN NM_000537
Insert Size 227 bp
Sequence Data
>SC202699 3’UTR clone of NM_000537
The sequence shown below is from the reference sequence of NM_000537. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCGCATTGGCTTCGCCTTGGCCCGCTGAGGCCCTCTGCCACCCAGGCAGGCCCTGCCTTCAGCCCTG
GCCCAGAGCTGGAACACTCTCTGAGATGCCCCTCTGCCTGGGCTTATGCCCTCAGATGGAGACATTGGA
TGTGGAGCTCCTGCTGGATGCGTGCCCTGACCCCTGCACCAGCCCTTCCCTGCTTTGAGGACAAAGAGA
ATAAAGACTTCATGTTCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000537.4
Synonyms ADTKD4; HNFJ2; RTD
Summary This gene encodes renin, an aspartic protease that is secreted by the kidneys. Renin is a part of the renin-angiotensin-aldosterone system involved in regulation of blood pressure, and electrolyte balance. This enzyme catalyzes the first step in the activation pathway of angiotensinogen by cleaving angiotensinogen to form angiotensin I, which is then converted to angiotensin II by angiotensin I converting enzyme. This cascade can result in aldosterone release, narrowing of blood vessels, and increase in blood pressure as angiotension II is a vasoconstrictive peptide. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause hyperuricemic nephropathy familial juvenile 2, familial hyperproreninemia, and renal tubular dysgenesis. [provided by RefSeq, May 2020]
Locus ID 5972
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...