NDUFA2 (NM_002488) Human 3' UTR Clone

CAT#: SC202685

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex2 8kDa (NDUFA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFA2 (NM_002488) Human 3' UTR Clone
Vector pMirTarget
Synonyms B8; CD14; CIB8; MC1DN13
ACCN NM_002488
Insert Size 332 bp
Sequence Data
>SC202685 3’UTR clone of NM_002488
The sequence shown below is from the reference sequence of NM_002488. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGAGAACGTTCTAAGTGGTAAAGCCTGAAGCCTCCACTGAGGATTAAGAGCAACAGCCCCAGAGCCT
GGGCTCTGCTGGACTTAGTATAATGTGAAAAAAATGTGTTCTCCTATTCCTCATAAAGCTTGTGCTGTA
AAATACTTTCTCAGGGTGTTCTTGTCCTCATCTACCCTCTACCCCTTACTGTGCAACCACTGAGGCAAA
GTAGCTTAATATAAAAATAAAACTTTATTCTGTCTCATCAAAAGCTACCAGCTGCTGAAGCAAACATGA
AGGGTGGCGGGGGGGCAGGGATTCTAGGGCCCCAGAGTAAGTAGACCACACTGAGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002488.5
Synonyms B8; CD14; CIB8; MC1DN13
Summary The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex 1), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane, and may be involved in regulating complex I activity or its assembly via assistance in redox processes. Mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Locus ID 4695
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...