DPEP1 (NM_004413) Human 3' UTR Clone

CAT#: SC202651

3' UTR clone of dipeptidase 1 (renal) (DPEP1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DPEP1 (NM_004413) Human 3' UTR Clone
Vector pMirTarget
Synonyms MBD1; MDP; RDP
ACCN NM_004413
Insert Size 241 bp
Sequence Data
>SC202651 3’UTR clone of NM_004413
The sequence shown below is from the reference sequence of NM_004413. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCCTGGTCCTCTGTCTGTCTCTCCTGTGAAACCTGGGAGACCAGAGTCCCCTTTAGGGTTCCCGGAGC
TCCGGGAAGACCCGCCCATCCCAGGACTCCAGATGCCAGGAGCCCTGCTGCCCACATGCAAGGACCAGC
ATCTCCTGAGAGGACGCCTGGGCTTACCTGGGGGGCAGGATGCCTGGGGACAGTTCAGGACACACACAC
AGTAGGCCCGCAATAAAAGCAACACCCCTTCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004413.4
Synonyms MBD1; MDP; RDP
Summary The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. [provided by RefSeq, Dec 2020]
Locus ID 1800
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...