FUS2 (NAT6) (NM_012191) Human 3' UTR Clone

CAT#: SC202633

3' UTR clone of N-acetyltransferase 6 (GCN5-related) (NAT6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FUS2 (NAT6) (NM_012191) Human 3' UTR Clone
Vector pMirTarget
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
ACCN NM_012191
Insert Size 231 bp
Sequence Data
>SC202633 3’UTR clone of NM_012191
The sequence shown below is from the reference sequence of NM_012191. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCATATTCTGGATGGAAAAAGACATCTGAGGCCATCCAGGGCAAGGAACTGTCTTTCTGGTTCAATAG
ACTGCCCCGACAGTCTACAAGCCTCAGCCCACTGACCATACCTCAGCCCCTAGCCCCTGGGGGGCAGCT
TTAACCTGGGCATGTTTCCTGGGTACCAGTGGGGCCAGGAGGTGGCTCTGGCTCAGAGCCGTCAGTGTG
GCTGAATAAAGGCTCTCTTGGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012191.4
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
Summary This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Locus ID 24142
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...