Protein Kinase D2 (PRKD2) (NM_001079881) Human 3' UTR Clone

CAT#: SC202624

3' UTR clone of protein kinase D2 (PRKD2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Protein Kinase D2 (PRKD2) (NM_001079881) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSPC187; nPKC-D2; PKD2
ACCN NM_001079881
Insert Size 237 bp
Sequence Data
>SC202624 3’UTR clone of NM_001079881
The sequence shown below is from the reference sequence of NM_001079881. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCTGGCGGAGCGCATCAGTGTTCTCTGAGGTCCTGTGCCCTCGTCCAGCTGCTGCCCTCCACAGCGG
TTCTTCACAGGATCCCAGCAATGAACTGTTCTAGGGAAAGTGGCTTCCTGCCCAAACTGGATGGGACAC
GTGGGGAGTGGGGTGGGGGGAGCTATTTCCAAGGCCCCTCCCTGTTTCCCCAGCAATTAAAACGGACTC
ATCTCTGGCCCCATGGCCTTGATCTCAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001079881.2
Synonyms HSPC187; nPKC-D2; PKD2
Summary The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 25865
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...