NELFE (NM_002904) Human 3' UTR Clone

CAT#: SC202594

3' UTR clone of RD RNA binding protein (RDBP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NELFE (NM_002904) Human 3' UTR Clone
Vector pMirTarget
Synonyms D6S45; NELF-E; RD; RDBP; RDP
ACCN NM_002904
Insert Size 244 bp
Sequence Data
>SC202594 3’UTR clone of NM_002904
The sequence shown below is from the reference sequence of NM_002904. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAAGGAAAACCTTGTGGATGGCTTCTAGGGAACAGAGCTGGATTCCTTGTGCCTCATATGCCCCAAT
GCTGGTCTCAGTAAAACACTGAGGTGGAAGCTTACACATCTCCCTCAGCCTCTGGTTTTTCAGCACTTG
GGATTGGGGTTAAACCTTTAAAAACGGCTGTCAGGTTTGATCTCAGTGTAACAACATGGCCAGTGCCTG
TTCCCCACTCCCTTGCCCCAAAAGGATCTGGAACACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002904.6
Synonyms D6S45; NELF-E; RD; RDBP; RDP
Summary The protein encoded by this gene is part of a complex termed negative elongation factor (NELF) which represses RNA polymerase II transcript elongation. This protein bears similarity to nuclear RNA-binding proteins; however, it has not been demonstrated that this protein binds RNA. The protein contains a tract of alternating basic and acidic residues, largely arginine (R) and aspartic acid (D). The gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. [provided by RefSeq, Jul 2008]
Locus ID 7936
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...