DOLK (NM_014908) Human 3' UTR Clone

CAT#: SC202580

3' UTR clone of dolichol kinase (DOLK) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DOLK (NM_014908) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDG1M; DK; DK1; SEC59; TMEM15
ACCN NM_014908
Insert Size 187 bp
Sequence Data
>SC202580 3’UTR clone of NM_014908
The sequence shown below is from the reference sequence of NM_014908. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTACCTCCTGATATTGCTGATGGCCTAGCTGTTACAGTGCAGCAGCAGTGACGGAGGAAACAGACAT
GGGGAGGGTGAACAGTCCCCACAGCAGACAGCTACTTGGGCATGAAGAGCCAAGGTGTGAAAAGCAGAT
TTGATTTTTCAGTTGATTCAGATTTAAAATAAAAAGCAAAGCTCTCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014908.4
Synonyms CDG1M; DK; DK1; SEC59; TMEM15
Summary The protein encoded by this gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man, which is an essential glycosyl carrier lipid for C- and O-mannosylation, N- and O-linked glycosylation of proteins, and for the biosynthesis of glycosyl phosphatidylinositol anchors in endoplasmic reticulum. Mutations in this gene are associated with dolichol kinase deficiency.[provided by RefSeq, Apr 2010]
Locus ID 22845
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...