MBD2 (NM_015832) Human 3' UTR Clone

CAT#: SC202568

3' UTR clone of methyl-CpG binding domain protein 2 (MBD2) transcript variant testis-specific for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MBD2 (NM_015832) Human 3' UTR Clone
Vector pMirTarget
Synonyms DMTase; NY-CO-41
ACCN NM_015832
Insert Size 255 bp
Sequence Data
>SC202568 3’UTR clone of NM_015832
The sequence shown below is from the reference sequence of NM_015832. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGGCAGAACCAATCCTTTCCTCCATAATGCTTCCCTGGTGCTTTGCCATTGTATTTGTGACTTGTT
TGTCTGCTTCAGCTAGACTGTGAGCTCCATGAGGGCAGGGACCATGTCTTTTTTTGCTTTTGCACACGG
TAGGTACTTAATATTGCTTTATGTTTATTTGATTTACCATCCACCTCATTCTAGAAGTGTATAGTGGTA
ATAAATGTTTATTAAATAAATAAATTATACCGTACATTATTTTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015832.6
Synonyms DMTase; NY-CO-41
Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Locus ID 8932
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...