CAVIN3 (NM_145040) Human 3' UTR Clone

CAT#: SC202558

3' UTR clone of protein kinase C delta binding protein (PRKCDBP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CAVIN3 (NM_145040) Human 3' UTR Clone
Vector pMirTarget
Synonyms cavin-3; HSRBC; PRKCDBP; SRBC
ACCN NM_145040
Insert Size 247 bp
Sequence Data
>SC202558 3’UTR clone of NM_145040
The sequence shown below is from the reference sequence of NM_145040. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTCTGCTCCAAATGGAGAGTGTAGCCTGAGGGCTGGTGTTGCCTGCCTCCCCTGTGCTTGTGCCTTGT
CCCAAAATAAATCCTTTCAGAATGTAGCACTCACGCCCTAATAAGGAGCGAATCCTACATCCACCAAGG
CGGGCGCTCTGGCCCTCCCTTCCTTAAGCCCAGTCCTGTGTCCTCTGAAAGAGGTGCAGTCACTCACAC
CTGCTTGCGCTCACCATCAATAAAAGTAATTTCACCCGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145040.3
Synonyms cavin-3; HSRBC; PRKCDBP; SRBC
Summary The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008]
Locus ID 112464
MW 9.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...