SAFB (NM_002967) Human 3' UTR Clone

CAT#: SC202530

3' UTR clone of scaffold attachment factor B (SAFB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SAFB (NM_002967) Human 3' UTR Clone
Vector pMirTarget
Synonyms HAP; HET; SAB-B1; SAF-B; SAF-B1; SAFB1
ACCN NM_002967
Insert Size 217 bp
Sequence Data
>SC202530 3’UTR clone of NM_002967
The sequence shown below is from the reference sequence of NM_002967. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCGATGCCCGCTTCACTCGCCGCTACTGAGTACTTGGAATCCTGTGTCCTGTCTCGTGGCAACAAGGC
TATGTTCTGTTAGGAGTTACCTTAAACTGTGTAAAAATATTTTTTTTTAATCTGCTGCCATATTGTAGC
TCAATACAATGTGAATTTGTTTTTCGTTTTGGGGTTTTTTTTTTTTGTAATAAATGTGTTTCCGTTCAC
ATACCCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002967.4
Synonyms HAP; HET; SAB-B1; SAF-B; SAF-B1; SAFB1
Summary This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
Locus ID 6294
MW 8.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...