UBA1 (NM_153280) Human 3' UTR Clone

CAT#: SC202515

3' UTR clone of ubiquitin-like modifier activating enzyme 1 (UBA1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UBA1 (NM_153280) Human 3' UTR Clone
Vector pMirTarget
Synonyms A1S9; A1S9T; A1ST; AMCX1; CFAP124; GXP1; POC20; SMAX2; UBA1A; UBE1; UBE1X; VEXAS
ACCN NM_153280
Insert Size 229 bp
Sequence Data
>SC202515 3’UTR clone of NM_153280
The sequence shown below is from the reference sequence of NM_153280. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTCCCTATGTCCGATACACCATCCGCTGACCCCGTCTGCTCCTCTAGGCTGGCCCCTTGTCCACCCCT
CTCCACACCCCTTCCAGCCCAGGGTTCCCATTTGGCTTCTGGCAGTGGCCCAACTAGCCAAGTCTGGTG
TTCCCTCATCATCCCCCTACCTGAACCCCTCTTGCCACTGCCTTCTACCTTGTTTGAAACCTGAATCCT
AATAAAGAATTAATAACTCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_153280.3
Synonyms A1S9; A1S9T; A1ST; AMCX1; CFAP124; GXP1; POC20; SMAX2; UBA1A; UBE1; UBE1X; VEXAS
Summary The protein encoded by this gene catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. This gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Locus ID 7317
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...