Cpn10 (HSPE1) (NM_002157) Human 3' UTR Clone

CAT#: SC202508

3' UTR clone of heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cpn10 (HSPE1) (NM_002157) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPN10; EPF; GROES; HSP10
ACCN NM_002157
Insert Size 220 bp
Sequence Data
>SC202508 3’UTR clone of NM_002157
The sequence shown below is from the reference sequence of NM_002157. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGACATTCTTGGAAAGTACGTAGACTGAAATAAGTCACTATTGAAATGGCATCAACATGATGCTGCC
CATTCCACTGAAGTTCTGAAATCTTTCGTCATGTAAATAATTTCCATATTTCTCTTTTATAATAAACTA
ATGATAACTAATGACATCCAGTGTCTCCAAAATTGTTTCCTTGTACTGATATAAACACTTCCAAATAAA
AATATGTAAATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002157.3
Synonyms CPN10; EPF; GROES; HSP10
Summary This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011]
Locus ID 3336
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...