SEC61B (NM_006808) Human 3' UTR Clone

CAT#: SC202505

3' UTR clone of Sec61 beta subunit (SEC61B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SEC61B (NM_006808) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_006808
Insert Size 221 bp
Sequence Data
>SC202505 3’UTR clone of NM_006808
The sequence shown below is from the reference sequence of NM_006808. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACATTTGGGGCAAGTACACTCGTTCGTAGATTCAGTTACATCCATCTGTCATCTGAAGAAGGAGGAAA
AAACCCAACATTTCTTGGACCAAAAGTATAGTGACTATCTGTTCATGAGAGAAATTTTCTGTAAGCTTG
CTGTTTTACAGGGGATTTATCAATAATTGATTTTGAGGAATCAGTTTTTTTCTATGGCTAATAAACTTT
TTAATTCACTTATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006808.3
Summary The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the beta-subunit protein. The Sec61 subunits are also observed in the post-ER compartment, suggesting that these proteins can escape the ER and recycle back. There is evidence for multiple polyadenylated sites for this transcript. [provided by RefSeq, Jul 2008]
Locus ID 10952
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...