CYP11A1 (NM_000781) Human 3' UTR Clone

CAT#: SC202479

3' UTR clone of cytochrome P450 family 11 subfamily A polypeptide 1 (CYP11A1) nuclear gene encoding mitochondrial protein transcript variant 1



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CYP11A1 (NM_000781) Human 3' UTR Clone
Vector pMirTarget
Synonyms CYP11A; CYPXIA1; P450SCC
ACCN NM_000781
Insert Size 240 bp
Sequence Data
>SC202479 3’UTR clone of NM_000781
The sequence shown below is from the reference sequence of NM_000781. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTTTAACCAGGAAGCAACCCAGCAGTGATCAGAGAGGATGGCCTGCAGCCACATGGGAGGAAGGCCC
AGGGGTGGGGCCCATGGGGTCTCTGCATCTTCAGTCGTCTGTCCCAAGTCCTGCTCCTTTCTGCCCAGC
CTGCTCAGCAGGTTGAATGGGTTCTCAGTGGTCACCTTCCTCAGCTCAGCTGGGCCACTCCTCTTCACC
CACCCCATGGAGACAATAAACAGCTGAACCATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000781.3
Synonyms CYP11A; CYPXIA1; P450SCC
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
Locus ID 1583
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...