LLGL2 (NM_001015002) Human 3' UTR Clone

CAT#: SC202477

3' UTR clone of lethal giant larvae homolog 2 (Drosophila) (LLGL2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LLGL2 (NM_001015002) Human 3' UTR Clone
Vector pMirTarget
Synonyms HGL; Hugl-2; LGL2
ACCN NM_001015002
Insert Size 192 bp
Sequence Data
>SC202477 3' UTR clone of NM_001015002
The sequence shown below is from the reference sequence of NM_001015002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGCCAGTAGGAGAGCTTCGGGAGTGGGTGCCCAGGGTTAGGTGTGGGAGGCATGGGGCAGGACCATCAG
TAAAGACAGGGCCAGGTGCAGTGGCTCCTGCCTGTAACCCCAGTGCTGTGGGAGGCCAAGGTGGTAGGAT
CGCTTGAACCCAGGAGTTCAAGTCCAGCCTGGACAACGTAGGGAGACCCTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001015002.1
Synonyms HGL; Hugl-2; LGL2
Summary The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 3993
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...