ADAMTS13 (NM_139026) Human 3' UTR Clone

CAT#: SC202455

3' UTR clone of ADAM metallopeptidase with thrombospondin type 1 motif 13 (ADAMTS13) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ADAMTS13 (NM_139026) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
ACCN NM_139026
Insert Size 236 bp
Sequence Data
>SC202455 3’UTR clone of NM_139026
The sequence shown below is from the reference sequence of NM_139026. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGTCCTGGAAGGGAAAGGAAGGAACCTGAGGGTCATTGAACATTTGTTCCGTGTCTGGCCAGCCCTGG
AGGGTTGACCCCTGGTCTCAGTGCTTTCCAATTCGAACTTTTTCCAATCTTAGGTATCTACTTTAGAGT
CTTCTCCAATGTCCAAAAGGCTAGGGGGTTGGAGGTGGGGACTCTGGAAAAGCAGCCCCCATTTCCTCG
GGTACCAATAAATAAAACATGCAGGCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139026.6
Synonyms ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
Summary This gene encodes a member of a family of proteins containing several distinct regions, including a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. The enzyme encoded by this gene specifically cleaves von Willebrand Factor (vWF). Defects in this gene are associated with thrombotic thrombocytopenic purpura. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 11093
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...