Neurokinin 1 Receptor (TACR1) (NM_015727) Human 3' UTR Clone

CAT#: SC202407

3' UTR clone of tachykinin receptor 1 (TACR1) transcript variant short for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Neurokinin 1 Receptor (TACR1) (NM_015727) Human 3' UTR Clone
Vector pMirTarget
Synonyms NK1R; NKIR; SPR; TAC1R
ACCN NM_015727
Insert Size 241 bp
Sequence Data
>SC202407 3’UTR clone of NM_015727
The sequence shown below is from the reference sequence of NM_015727. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCATCTACTGCTGCCTCAATGACAGGTGAGGATCCCAACCCCATGAGCTCTCCAGGGGCCACAAGACC
ATCTACATACACAGTGGCCAAGCGGCCATCCTAAATGAGTAAACCCAGCTGTGAGACAAGAGGGACAAG
TGGGGACTGCAGCTAACTTATCATCACACAACTCAGCCTGGCTGATTATCACCATCCAGGAATGGGAGC
CCGGAGTGGACTGATTTTCTTTTTTTCTTTTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015727.3
Synonyms NK1R; NKIR; SPR; TAC1R
Summary This gene belongs to a gene family of tachykinin receptors. These tachykinin receptors are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin substance P, also referred to as neurokinin 1. The encoded protein is also involved in the mediation of phosphatidylinositol metabolism of substance P. [provided by RefSeq, Sep 2008]
Locus ID 6869
MW 9.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...