Fibrinogen gamma chain (FGG) (NM_000509) Human 3' UTR Clone

CAT#: SC202397

3' UTR clone of fibrinogen gamma chain (FGG) transcript variant gamma-A for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Fibrinogen gamma chain (FGG) (NM_000509) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000509
Insert Size 234 bp
Sequence Data
>SC202397 3’UTR clone of NM_000509
The sequence shown below is from the reference sequence of NM_000509. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGGAGCCAAACAGGCTGGAGACGTTTAAAAGACCGTTTCAAAAGAGATTTACTTTTTTAAAGGACTT
TATCTGAACAGAGAGATATAATATTTTTCCTATTGGACAATGGACTTGCAAAGCTTCACTTCATTTTAA
GAGCAAAAGACCCCATGTTGAAAACTCCATAACAGTTTTATGCTGATGATAATTTATCTACATGCATTT
CAATAAACCTTTTGTTTCCTAAGACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000509.6
Summary The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Locus ID 2266
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...