Complement factor 8 beta (C8B) (NM_000066) Human 3' UTR Clone

CAT#: SC202395

3' UTR clone of complement component 8 beta polypeptide (C8B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Complement factor 8 beta (C8B) (NM_000066) Human 3' UTR Clone
Vector pMirTarget
Synonyms C82
ACCN NM_000066
Insert Size 227 bp
Sequence Data
>SC202395 3’UTR clone of NM_000066
The sequence shown below is from the reference sequence of NM_000066. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTGCTTCAGAAACACTTGACTGCTCCTAGCAGATGATACAGCAGTGGGCTACATACAATGAGAGCCCT
GAGCCCTCAAGAACTCATGCCAGCTCAGCCCTACACCAGTTTCCACCTGGAGTTCATGCAAGGGCAAAA
GGCAGTGCCATGCAAGCTGTTTAAAATAAAGATGTTACCTTGTAAAATGCAAGTTGATTTAAATAAATA
CTGAGTTAAAGGCTTAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000066.4
Synonyms C82
Summary This gene encodes one of the three subunits of the complement component 8 (C8) protein. C8 is composed of equimolar amounts of alpha, beta and gamma subunits, which are encoded by three separate genes. C8 is one component of the membrane attack complex, which mediates cell lysis, and it initiates membrane penetration of the complex. This protein mediates the interaction of C8 with the C5b-7 membrane attack complex precursor. In humans deficiency of this protein is associated with increased risk of meningococcal infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Locus ID 732
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...