CD163L1 (NM_174941) Human 3' UTR Clone

CAT#: SC202389

3' UTR clone of CD163 molecule-like 1 (CD163L1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD163L1 (NM_174941) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD163B; M160; SCARI2; WC1
ACCN NM_174941
Insert Size 225 bp
Sequence Data
>SC202389 3’UTR clone of NM_174941
The sequence shown below is from the reference sequence of NM_174941. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTCTTCCTGCCTCTGAAGCCACAAAATGACTTTAGACTTCCAGGGCTCACCAGATCAACCTCTAAATA
TCTTTGAAGGAGACAACAACTTTTAAATGAATAAAGAGGAAGTCAAGTTGCCCTATGGAAAACTTGTCC
AAATAACATTTCTTGAACAATAGGAGAACAGCTAAATTGATAAAGACTGGTGATAATAAAAATTGAATT
ATGTATATCACTGTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_174941.6
Synonyms CD163B; M160; SCARI2; WC1
Summary This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. The SRCR family is defined by a 100-110 amino acid SRCR domain, which may mediate protein-protein interaction and ligand binding. The encoded protein contains twelve SRCR domains, a transmembrane region and a cytoplasmic domain. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Locus ID 283316
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...