Creatine kinase B type (CKB) (NM_001823) Human 3' UTR Clone

CAT#: SC202330

3' UTR clone of creatine kinase brain (CKB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Creatine kinase B type (CKB) (NM_001823) Human 3' UTR Clone
Vector pMirTarget
Synonyms B-CK; BCK; CKBB; CPK-B; HEL-211; HEL-S-29
ACCN NM_001823
Insert Size 227 bp
Sequence Data
>SC202330 3’UTR clone of NM_001823
The sequence shown below is from the reference sequence of NM_001823. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCGACGACCTCATGCCTGCCCAGAAATGAAGCCCGGCCCACACCCGACACCAGCCCTGCTGCTTCCTA
ACTTATTGCCTGGGCAGTGCCCACCATGCACCCCTGATGTTCGCCGTCTGGCGAGCCCTTAGCCTTGCT
GTAGAGACTTCCGTCACCCTTGGTAGAGTTTATTTTTTTGATGGCTAAGATACTGCTGATGCTGAAATA
AACTAGGGTTTTGGCCTGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001823.5
Synonyms B-CK; BCK; CKBB; CPK-B; HEL-211; HEL-S-29
Summary The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]
Locus ID 1152
MW 8.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...