CDK5RAP1 (NM_016082) Human 3' UTR Clone

CAT#: SC202312

3' UTR clone of CDK5 regulatory subunit associated protein 1 (CDK5RAP1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CDK5RAP1 (NM_016082) Human 3' UTR Clone
Vector pMirTarget
Synonyms C20orf34; C42; CGI-05; HSPC167
ACCN NM_016082
Insert Size 247 bp
Sequence Data
>SC202312 3’UTR clone of NM_016082
The sequence shown below is from the reference sequence of NM_016082. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTCTGAGGGACTCTTCTGCATATTGCTGACCTGAGAGGATGGCCTCAGAGCTGACTTGGGCAATCCTC
CCCAACAGGAAGGGGAGACATTGCCTGCCACTGAGGAAACAGGTCATGAAGGTGGAGATAAGCTGCAAG
GGGCGAAGCAACTTTATGTCAGTGGAAAACGTGTCTCTTTAAAGCTGCTATGTGAACAGCTTTTACAGT
CATTAAATTTACCTAAACTAAGGTTAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016082.4
Synonyms C20orf34; C42; CGI-05; HSPC167
Summary This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
Locus ID 51654
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...