DNA Ligase I (LIG1) (NM_000234) Human 3' UTR Clone

CAT#: SC202304

3' UTR clone of ligase I DNA ATP-dependent (LIG1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DNA Ligase I (LIG1) (NM_000234) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000234
Insert Size 234 bp
Sequence Data
>SC202304 3’UTR clone of NM_000234
The sequence shown below is from the reference sequence of NM_000234. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGGCTCTGACCCTGAAGATACCTACTAAGCCCTCGCCCTCCTAGGGCCTGGGTACAGGGCATGAGTT
GGACGGACCCCAGGGTTATTATTGCCTTTGCTTTTTAGCAAATCTGCTGTGGCAGGCTGTGGATTTTGA
GAGTCAGGGGAGGGGTGTGTGTGTGAGGGGGTGGCTTACTCCGGAGTCTGGGATTCATCCCGTCATTTC
TTTCAATAAATAATTATTGGATAGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000234.3
Summary This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Locus ID 3978
MW 8.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...