CACNA1G (NM_198397) Human 3' UTR Clone

CAT#: SC202290

3' UTR clone of calcium channel voltage-dependent T type alpha 1G subunit (CACNA1G) transcript variant 15 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CACNA1G (NM_198397) Human 3' UTR Clone
Vector pMirTarget
Synonyms Ca(V)T.1; Cav3.1; MGC117234; NBR13
ACCN NM_198397
Insert Size 233 bp
Sequence Data
>SC202290 3’UTR clone of NM_198397
The sequence shown below is from the reference sequence of NM_198397. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGAAGAAACAGAGGCTCAGAGAGGGTAAGGGGCTTGCCCAGGGCCACAGAGCTACATGGTGGAGCAG
GAAGCACACGTGGCAGTGGGGGCAGGCAGCCCTGGATGTGAATCCTGTGCAAATCCTGACCCCACCATT
GTCAGCTCAGTGACCTGGAGCAGCTGACTTACCAGGGCCTCAGTTTCATTAACTGGTGAATGGAGTCAT
AATAGAATCTCCTCGGAGGTCACAAT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198397.1
Synonyms Ca(V)T.1; Cav3.1; MGC117234; NBR13
Summary Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
Locus ID 8913
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...