ALG3 (NM_005787) Human 3' UTR Clone

CAT#: SC202276

3' UTR clone of asparagine-linked glycosylation 3 alpha-13- mannosyltransferase homolog (S. cerevisiae) (ALG3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ALG3 (NM_005787) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDG1D; CDGS4; CDGS6; D16Ertd36e; not; Not56; NOT56L
ACCN NM_005787
Insert Size 243 bp
Sequence Data
>SC202276 3’UTR clone of NM_005787
The sequence shown below is from the reference sequence of NM_005787. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCACCCAACACAGCAAGAAAGCCCACTGAAGTCCACCCCTTTCCCTCAGGACCTGAGTCTACCCTCAG
GACCTGGGGTTGGTTGGACTCTGCCCTTCCAAATAAACCTTGCTAAGTCCAACTCTGTGCAACCTACAT
GGAGGTGGGGGCAGCCGATGCCTGGTCCAGGCTGTGAGGGACACGTATGGAGCAGATAAAGAATTCACT
CAAGCAGTCCTAAGAGGCACTTTATTGCATAGGATT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005787.6
Synonyms CDG1D; CDGS4; CDGS6; D16Ertd36e; not; Not56; NOT56L
Summary This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Locus ID 10195
MW 8.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...