FOLR2 (NM_001113536) Human 3' UTR Clone

CAT#: SC202270

3' UTR clone of folate receptor 2 (fetal) (FOLR2) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FOLR2 (NM_001113536) Human 3' UTR Clone
Vector pMirTarget
Synonyms BETA-HFR; FBP; FBP/PL-1; FOLR1; FR-BETA; FR-P3; FRbeta
ACCN NM_001113536
Insert Size 201 bp
Sequence Data
>SC202270 3' UTR clone of NM_001113536
The sequence shown below is from the reference sequence of NM_001113536. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGATGCTGCAACTCTGGCTCCTTGGCTGAGTTCAGTCCTCCCAGACTACCTGCCCTCAGCTTGGATAACC
AGGCTGGGCTCAGCTCAGCTCCCACAAATGACAGCCCCTTAAGCATGCTTCTATTAGTCACCTAACCCTC
TGTCACCCAGTCTGTTGCTGCTCCATGGTGGGGCCAAGAGTCACTTCTAATAAACAGACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001113536.1
Synonyms BETA-HFR; FBP; FBP/PL-1; FOLR1; FR-BETA; FR-P3; FRbeta
Summary The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11. Members of this gene family have a high affinity for folic acid and for several reduced folic acid derivatives, and they mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This protein has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. Although this protein was originally thought to be specific to placenta, it can also exist in other tissues, and it may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. Multiple transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2350
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...