Lactate Dehydrogenase B (LDHB) (NM_002300) Human 3' UTR Clone

CAT#: SC202264

3' UTR clone of lactate dehydrogenase B (LDHB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Lactate Dehydrogenase B (LDHB) (NM_002300) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5
ACCN NM_002300
Insert Size 230 bp
Sequence Data
>SC202264 3’UTR clone of NM_002300
The sequence shown below is from the reference sequence of NM_002300. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACATCCAGAAGGACCTAAAAGACCTGTGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAAT
GTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGATCACAGTTTGCTTTGATCTTCTTCAATA
TGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTGCAATCTGAGCTCTTGAACAA
ATAAAATTAACTATTGTAGTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002300.8
Synonyms HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5
Summary This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016]
Locus ID 3945
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...