Ribonuclease Inhibitor (RNH1) (NM_203389) Human 3' UTR Clone

CAT#: SC202200

3' UTR clone of ribonuclease/angiogenin inhibitor 1 (RNH1) transcript variant 8 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Ribonuclease Inhibitor (RNH1) (NM_203389) Human 3' UTR Clone
Vector pMirTarget
Synonyms RAI; RNH
ACCN NM_203389
Insert Size 206 bp
Sequence Data
>SC202200 3’UTR clone of NM_203389
The sequence shown below is from the reference sequence of NM_203389. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACAAGCCATCCCTGAGGGTCATCTCCTGAGGCTCTTCCTGCTGCTGCTCTCCCTGGACGACCGGCCTC
GAGGCAACCCTGGGGCCCACCAGCCCCTGCCATGCTCTCACCCTGCATATCCTAGGTTTGAAGAGAAAC
GCTCAGATCCGCTTATTTCTGCCAGTATATTTTGGACACTTTATAATCATTAAAGCACTTTCTTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203389.3
Synonyms RAI; RNH
Summary Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]
Locus ID 6050
MW 7.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...