beta II Tubulin (TUBB2A) (NM_001069) Human 3' UTR Clone

CAT#: SC202177

3' UTR clone of tubulin beta 2A (TUBB2A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name beta II Tubulin (TUBB2A) (NM_001069) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDCBM5; TUBB; TUBB2
ACCN NM_001069
Insert Size 227 bp
Sequence Data
>SC202177 3’UTR clone of NM_001069
The sequence shown below is from the reference sequence of NM_001069. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGGAGGAGGGCGAGGACGAGGCTTAAAAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCT
GTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTGCTCAGTTTTGCCTCTGTTAGAAATTCAC
ACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTGAAGGTATCTATACTAAT
AAAAAAGCATGTGTAGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001069.3
Synonyms CDCBM5; TUBB; TUBB2
Summary Microtubules, key participants in processes such as mitosis and intracellular transport, are composed of heterodimers of alpha- and beta-tubulins. The protein encoded by this gene is a beta-tubulin. Defects in this gene are associated with complex cortical dysplasia with other brain malformations-5. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
Locus ID 7280
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...