CARS (NM_001014438) Human 3' UTR Clone

CAT#: SC202175

3' UTR clone of cysteinyl-tRNA synthetase (CARS) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CARS (NM_001014438) Human 3' UTR Clone
Vector pMirTarget
Synonyms CARS1; CYSRS; cysteine-tRNA ligase; cysteine translase; cysteine tRNA ligase 1, cytoplasmic; cysteinyl-tRNA synthetase; MGC:11246; OTTHUMP00000012605
ACCN NM_001014438
Insert Size 227 bp
Sequence Data
>SC202175 3’UTR clone of NM_001014438
The sequence shown below is from the reference sequence of NM_001014438. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGATGGCCCAGAATGGAAGCTTCCAGTGAGGGGGCACAGGACTGACTTTTTAAACCATTGTGGACTAG
TGGCTGCTGTCTGCCTCAGTGACAATGTCCCAGCGCTCCTATCATGTTTACAGTCACCCTTGGGTCCTA
AATTAAGAGTTGTGTTCATGTAGGTTCGTGTCGTCGTTGGCTCTGAGACATTGATAATAAATTTTTCTC
AACAGTGAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001014438.1
Synonyms CARS1; CYSRS; cysteine-tRNA ligase; cysteine translase; cysteine tRNA ligase 1, cytoplasmic; cysteinyl-tRNA synthetase; MGC:11246; OTTHUMP00000012605
Summary This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Locus ID 833
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...