NCF4 (NM_000631) Human 3' UTR Clone

CAT#: SC202167

3' UTR clone of neutrophil cytosolic factor 4 40kDa (NCF4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NCF4 (NM_000631) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGD3; NCF; P40PHOX; SH3PXD4
ACCN NM_000631
Insert Size 222 bp
Sequence Data
>SC202167 3’UTR clone of NM_000631
The sequence shown below is from the reference sequence of NM_000631. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTACAGGGTCTACAACACGATGCCATGAGCTGACGGTGTCCCTGGAGCAGTGAGGGGACACCAGCAA
AAACCTTCAGCTCTCAGAGGAGATTGGGACCAGGAAAACCTGGGAGGATGGGCAGACTTCCTGTCTTTG
AGGCTAATGGACCCGTGGGGCTTGTAATCTGTCTCTTTCTACTATTTACATCTGATTTAAATAAACCAT
TCCATCTGAAAGGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000631.5
Synonyms CGD3; NCF; P40PHOX; SH3PXD4
Summary The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 4689
MW 8.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...