Cardiac Troponin T (TNNT2) (NM_001001431) Human 3' UTR Clone

CAT#: SC202145

3' UTR clone of troponin T type 2 (cardiac) (TNNT2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cardiac Troponin T (TNNT2) (NM_001001431) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
ACCN NM_001001431
Insert Size 226 bp
Sequence Data
>SC202145 3’UTR clone of NM_001001431
The sequence shown below is from the reference sequence of NM_001001431. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGCTAAAGTCACCGGGCGCTGGAAATAGAGCCTGGCCTCCTTCACCAAAGATCTGCTCCTCGCTCGC
ACCTGCCTCCGGCCTGCACTCCCCCAGTTCCCGGGCCCTCCTGGGCACCCCAGGCAGCTCCTGTTTGGA
AATGGGGAGCTGGCCTAGGTGGGAGCCACCACTCCTGCCTGCCCCCACACCCACTCCACACCAGTAATA
AAAAGCCACCACACACTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001431.3
Synonyms CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
Summary The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
Locus ID 7139
MW 8.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...