SIVA (SIVA1) (NM_021709) Human 3' UTR Clone

CAT#: SC202091

3' UTR clone of SIVA1 apoptosis-inducing factor (SIVA1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SIVA (SIVA1) (NM_021709) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD27BP; SIVA; Siva-1; Siva-2
ACCN NM_021709
Insert Size 199 bp
Sequence Data
>SC202091 3’UTR clone of NM_021709
The sequence shown below is from the reference sequence of NM_021709. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCACCAGCTGTGCCATGTTCGAGACCTGAGGCTGGCTCAAGCCGGCTGCCTTCACCGGGAGCCACGCC
GTGCATGGCAGCCTTCCCTGGACGAGCGCTCGGTGTTCACACTGAACTGTGGGGTCGACGGGAGGGGTG
CCTTTTACATGTTCTATTTTGTATCCTAATGACAGAATGAATAAACCTCTTTATATTTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021709.3
Synonyms CD27BP; SIVA; Siva-1; Siva-2
Summary This gene encodes an E3 ubiquitin ligase that regulates cell cycle progression, cell proliferation and apoptosis. The N-terminus of this protein binds to the cytoplasmic tail of the CD27 antigen, a member of the tumor necrosis factor receptor (TNFR) superfamily. In response to UV radiation-induced DNA damage, this protein has been shown to mediate the ubiquitination of proliferating cell nuclear antigen (PCNA), an important step in translesion DNA synthesis. [provided by RefSeq, Sep 2018]
Locus ID 10572
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...