Apc2 (ANAPC2) (NM_013366) Human 3' UTR Clone

CAT#: SC202077

3' UTR clone of anaphase promoting complex subunit 2 (ANAPC2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apc2 (ANAPC2) (NM_013366) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC2
ACCN NM_013366
Insert Size 188 bp
Sequence Data
>SC202077 3’UTR clone of NM_013366
The sequence shown below is from the reference sequence of NM_013366. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCTACCGCCTGCCCAAGAACTGCAGCTGACACATCGCCCGCCCGCCCGCCCGCCCGCCAGGCGCTGCC
CTGCAGGTGCTCTCGTCCTCCCGTGCCAGCCCCCGCCCGCCCGTGTCCCAGAATGCACTGCTGAGGAGC
ATGCCCACCCCCACCCCCGCAGTGTGCAGATTAAAGCAAGTCAGATCATC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013366.4
Synonyms APC2
Summary A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The product of this gene is a component of the complex and shares sequence similarity with a recently identified family of proteins called cullins, which may also be involved in ubiquitin-mediated degradation. [provided by RefSeq, Jul 2008]
Locus ID 29882
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...