Liprin alpha 1 (PPFIA1) (NM_177423) Human 3' UTR Clone

CAT#: SC202051

3' UTR clone of protein tyrosine phosphatase receptor type f polypeptide (PTPRF) interacting protein (liprin) alpha 1 (PPFIA1) transcript variant 1



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Liprin alpha 1 (PPFIA1) (NM_177423) Human 3' UTR Clone
Vector pMirTarget
Synonyms LIP.1; LIP1; LIPRIN
ACCN NM_177423
Insert Size 298 bp
Sequence Data
>SC202051 3’UTR clone of NM_177423
The sequence shown below is from the reference sequence of NM_177423. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAAAGAAGATGCAGATGGACGGTATGTGATGGGTCACACTAACCTGTCACTTGTTGGGAGCATGAGCA
GCTTTCTGTCTGGAACATTAATAATGATCTAAAACGGCCTATTTAATATGTTACAAGGCACTTGAGTAT
GGTTGCATGTCCAAATATAAATGTTTTTAAATTAACTCTAACATTTGTTTATAAAAGTTTAACCATAAT
AATAGAATTTTTAAAACACGCTTGTCTGGTTGAATCTTAGCATATTTTTCCAACTAATAAAGCTCAGTA
TTCGTCTGTGTTCTCAGAGAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177423.3
Synonyms LIP.1; LIP1; LIPRIN
Summary The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 8500
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...