alpha smooth muscle Actin (ACTA2) (NM_001141945) Human 3' UTR Clone

CAT#: SC202049

3' UTR clone of actin alpha 2 smooth muscle aorta (ACTA2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name alpha smooth muscle Actin (ACTA2) (NM_001141945) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACTSA
ACCN NM_001141945
Insert Size 219 bp
Sequence Data
>SC202049 3’UTR clone of NM_001141945
The sequence shown below is from the reference sequence of NM_001141945. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTTCCATTGTCCACCGCAAATGCTTCTAAAACACTTTCCTGCTCCTCTCTGTCTCTAGCACACAACTG
TGAATGTCCTGTGGAATTATGCCTTCAGTTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGTTA
CCTATGTGTTTTTTAATAAATCTGAAATAGGCTACTGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001141945.2
Synonyms ACTSA
Summary This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]
Locus ID 59
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...