AKR1C4 (NM_001818) Human 3' UTR Clone

CAT#: SC202044

3' UTR clone of aldo-keto reductase family 1 member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase type I; dihydrodiol dehydrogenase 4) (AKR1C4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKR1C4 (NM_001818) Human 3' UTR Clone
Vector pMirTarget
Synonyms 3-alpha-HSD; C11; CDR; CHDR; DD-4; DD4; HAKRA
ACCN NM_001818
Insert Size 203 bp
Sequence Data
>SC202044 3' UTR clone of NM_001818
The sequence shown below is from the reference sequence of NM_001818. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGGACCATCCTGATTATCCATTTTCAGATGAATATTAGCATAGAGGGTGTTGCACGACATCTAGCAGAA
GGCCCTGTGTGTGGATGGTGATGCAGAGGATGTCTCTATGCTGGTGACTGGACACACAGCCTCTGGTTAA
ATCCCTCCCCTCCTGCTTGGCAACTTCAGCTAGCTAGATATATCCATGGTCCAGAAAGCAAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001818.2
Synonyms 3-alpha-HSD; C11; CDR; CHDR; DD-4; DD4; HAKRA
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Locus ID 1109
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...