BCL2A1 (NM_004049) Human 3' UTR Clone

CAT#: SC202037

3' UTR clone of BCL2-related protein A1 (BCL2A1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BCL2A1 (NM_004049) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACC-1; ACC-2; ACC1; ACC2; BCL2L5; BFL1; GRS; HBPA1
ACCN NM_004049
Insert Size 205 bp
Sequence Data
>SC202037 3’UTR clone of NM_004049
The sequence shown below is from the reference sequence of NM_004049. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGCTATCTCTCCTGAAGCAATACTGTTGACCAGAAAGGACACTCCATATTGTGAAACCGGCCTAATTT
TTCTGACTGATATGGAAACGATTGCCAACACATACTTCTACTTTTAAATAAACAACTTTGATGATGTAA
CTTGACCTTCCAGAGTTATGGAAATTTTGTCCCCATGTAATGAATAAATTGTATGTATTTTTCTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004049.4
Synonyms ACC-1; ACC-2; ACC1; ACC2; BCL2L5; BFL1; GRS; HBPA1
Summary This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 597
MW 8.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...