CUEDC2 (NM_024040) Human 3' UTR Clone

CAT#: SC202021

3' UTR clone of CUE domain containing 2 (CUEDC2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CUEDC2 (NM_024040) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA18I14.5; C10orf66
ACCN NM_024040
Insert Size 194 bp
Sequence Data
>SC202021 3' UTR clone of NM_024040
The sequence shown below is from the reference sequence of NM_024040. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGCCAGAAAGTACCGCTTCCATTGAGGCACTCGCCGGACTCTGCCCGAGCCTTCTAGGCTCAGATCCCA
GAGGGATGCAGGAGCCCTATACCCCTACACAGGGGCCCCCTAACTCCTGTCCCCCTTCTCTACTCCTTTG
CTCCATAGTGTTAACCTACTCTCGGAGCTGCCTCCATGGGCACAGTAAAGGTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024040.2
Synonyms bA18I14.5; C10orf66
Summary Down-regulates ESR1 protein levels through the ubiquitination-proteasome pathway, regardless of the presence of 17 beta-estradiol. Also involved in 17 beta-estradiol-induced ESR1 degradation. Controls PGR protein levels through a similar mechanism.[UniProtKB/Swiss-Prot Function]
Locus ID 79004
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...