Apolipoprotein CIII (APOC3) (NM_000040) Human 3' UTR Clone

CAT#: SC202007

3' UTR clone of apolipoprotein C-III (APOC3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apolipoprotein CIII (APOC3) (NM_000040) Human 3' UTR Clone
Vector pMirTarget
Synonyms APOCIII
ACCN NM_000040
Insert Size 218 bp
Sequence Data
>SC202007 3’UTR clone of NM_000040
The sequence shown below is from the reference sequence of NM_000040. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGC
GAGCTCCTTGGGTCCTGCAATCTCCAGGGCTGCCCCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGT
GCTCTCCTACCCCACCTCATGCCTGGCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGA
AGCTGCTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000040.3
Synonyms APOCIII
Summary This gene encodes a protein component of triglyceride (TG)-rich lipoproteins (TRLs) including very low density lipoproteins (VLDL), high density lipoproteins (HDL) and chylomicrons. The encoded protein plays a role in role in the metabolism of these TRLs through multiple modes. This protein has been shown to promote the secretion of VLDL1, inhibit lipoprotein lipase enzyme activity, and delay catabolism of TRL remnants. Mutations in this gene are associated with low plasma triglyceride levels and reduced risk of ischemic cardiovascular disease, and hyperalphalipoproteinemia, which is characterized by elevated levels of high density lipoprotein (HDL) and HDL cholesterol in human patients. This gene and other related genes comprise an apolipoprotein gene cluster on chromosome 11. [provided by RefSeq, Sep 2017]
Locus ID 345
MW 7.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...