Cyclin B2 (CCNB2) (NM_004701) Human 3' UTR Clone

CAT#: SC201975

3' UTR clone of cyclin B2 (CCNB2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cyclin B2 (CCNB2) (NM_004701) Human 3' UTR Clone
Vector pMirTarget
Synonyms HsT17299
ACCN NM_004701
Insert Size 198 bp
Sequence Data
>SC201975 3’UTR clone of NM_004701
The sequence shown below is from the reference sequence of NM_004701. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTGCCTCCCCACTGATAGGAAGGTCCTAGGCTGCCGTGGCCCCTGGGGATGTGTGCTTCATTGTGCCC
TTTTTCTTATTGGTTTAGAACTCTTGATTTTGTACATAGTCCTCTGGTCTATCTCATGAAACCTCTTCT
CAGACCAGTTTTCTAAACATATATTGAGGAAAAATAAAGCGATTGGTTTTTCTTAAGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004701.4
Synonyms HsT17299
Summary Cyclin B2 is a member of the cyclin family, specifically the B-type cyclins. The B-type cyclins, B1 and B2, associate with p34cdc2 and are essential components of the cell cycle regulatory machinery. B1 and B2 differ in their subcellular localization. Cyclin B1 co-localizes with microtubules, whereas cyclin B2 is primarily associated with the Golgi region. Cyclin B2 also binds to transforming growth factor beta RII and thus cyclin B2/cdc2 may play a key role in transforming growth factor beta-mediated cell cycle control. [provided by RefSeq, Jul 2008]
Locus ID 9133
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...