FIG4 (NM_014845) Human 3' UTR Clone

CAT#: SC201967

3' UTR clone of FIG4 homolog SAC1 lipid phosphatase domain containing (S. cerevisiae) (FIG4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FIG4 (NM_014845) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALS11; BTOP; CMT4J; dJ249I4.1; KIAA0274; SAC3; YVS
ACCN NM_014845
Insert Size 191 bp
Sequence Data
>SC201967 3’UTR clone of NM_014845
The sequence shown below is from the reference sequence of NM_014845. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGAGAGTACATCAGGAACCGCTACCTGTGAAAAGAGCGCAGGTCCACCTGGTGGACACGTCTGATTAGC
TTAGAACCTGTCTTGTCTCATCTTCAAAAGGTAACTTATTAAAAGTCCTTTGCGTCTGAAGCCTTTCTC
CTTTTCTGTCACTTGCAAATTCCAAATTATAGCTAATAAAGATGACTAGATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014845.6
Synonyms ALS11; BTOP; CMT4J; dJ249I4.1; KIAA0274; SAC3; YVS
Summary The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
Locus ID 9896
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...