TFB1M (NM_016020) Human 3' UTR Clone

CAT#: SC201962

3' UTR clone of transcription factor B1 mitochondrial (TFB1M) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TFB1M (NM_016020) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-75; CGI75; mtTFB; mtTFB1
ACCN NM_016020
Insert Size 185 bp
Sequence Data
>SC201962 3' UTR clone of NM_016020
The sequence shown below is from the reference sequence of NM_016020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAGAGGATGACGCAGAGAATTACAGACTCTAGCTGCTGCCTGGGGGCGAGCAGCCTACCAGATGTCGAT
TTGCACTACGTGGAGCTTCTTATATAGGTACTCTTTTGTCTTTACAGAATGACGATACAAATGCCAATGA
CCAGATGTGACTTATTTTCCTTTTACTATACAGCTTGGCAGAGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016020.2
Synonyms CGI-75; CGI75; mtTFB; mtTFB1
Summary The protein encoded by this gene is a dimethyltransferase that methylates the conserved stem loop of mitochondrial 12S rRNA. The encoded protein also is part of the basal mitochondrial transcription complex and is necessary for mitochondrial gene expression. The methylation and transcriptional activities of this protein are independent of one another. Variations in this gene may influence the severity of aminoglycoside-induced deafness (AID).[provided by RefSeq, Aug 2010]
Locus ID 51106
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...