REC8 (NM_005132) Human 3' UTR Clone

CAT#: SC201932

3' UTR clone of REC8 homolog (yeast) (REC8) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name REC8 (NM_005132) Human 3' UTR Clone
Vector pMirTarget
Synonyms HR21spB; REC8L1; Rec8p
ACCN NM_005132
Insert Size 189 bp
Sequence Data
>SC201932 3’UTR clone of NM_005132
The sequence shown below is from the reference sequence of NM_005132. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGATCCAGCCGGGGCCCAGATTCCACTGAGGTTAGAGTCCATTTACAAAGCTGCCAGGAAACCGGCCA
CTTCTAGTAAACCACGTCGTGCCTCACTGGGTCCTGCTTACCTCATTTCTGAATGTGCATTTCCAGCCT
TCTTGCTCTCAGAGCTATTGTTCAAGCAGAAAACAAGCTGCTTTTATTACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005132.3
Synonyms HR21spB; REC8L1; Rec8p
Summary This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 9985
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...