CD41 (ITGA2B) (NM_000419) Human 3' UTR Clone

CAT#: SC201924

3' UTR clone of integrin alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex antigen CD41) (ITGA2B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD41 (ITGA2B) (NM_000419) Human 3' UTR Clone
Vector pMirTarget
Synonyms BDPLT2; BDPLT16; CD41; CD41B; GP2B; GPIIb; GT; GT1; GTA; HPA3; PPP1R93
ACCN NM_000419
Insert Size 213 bp
Sequence Data
>SC201924 3’UTR clone of NM_000419
The sequence shown below is from the reference sequence of NM_000419. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGAAGAAGATGATGAAGAGGGGGAGTGATGGTGCAGCCTACACTATTCTAGCAGGAGGGTTGGGCGT
GCTACCTGCACCGCCCCTTCTCCAACAAGTTGCCTCCAAGCTTTGGGTTGGAGCTGTTCCATTGGGTCC
TCTTGGTGTCGTTTCCCTCCCAACAGAGCTGGGCTACCCCCCCTCCTGCTGCCTAATAAAGAGACTGAG
CCCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000419.5
Synonyms BDPLT2; BDPLT16; CD41; CD41B; GP2B; GPIIb; GT; GT1; GTA; HPA3; PPP1R93
Summary This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
Locus ID 3674
MW 7.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...