WNK2 (NM_006648) Human 3' UTR Clone

CAT#: SC201899

3' UTR clone of WNK lysine deficient protein kinase 2 (WNK2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name WNK2 (NM_006648) Human 3' UTR Clone
Vector pMirTarget
Synonyms NY-CO-43; P/OKcl.13; PRKWNK2; SDCCAG43
ACCN NM_006648
Insert Size 173 bp
Sequence Data
>SC201899 3' UTR clone of NM_006648
The sequence shown below is from the reference sequence of NM_006648. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGAGTGAGAAGCCTGACTGACCCCGCCTAGACGCCAGGCCCACTTCACGCCGTCTAAGTGGAGAAGTGA
CGGACCCTCAGGGCCAGCTGCTCCTCCTGTCCAGTTCACGCTGTTTTGTAACCACTTTCTAAGCATTTTT
TATTCACAATTGGAAACACAAATGTAATGCAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006648.3
Synonyms NY-CO-43; P/OKcl.13; PRKWNK2; SDCCAG43
Summary The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Locus ID 65268
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...