IL4R (NM_001008699) Human 3' UTR Clone

CAT#: SC201898

3' UTR clone of interleukin 4 receptor (IL4R) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IL4R (NM_001008699) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD124; IL4RA
ACCN NM_001008699
Insert Size 198 bp
Sequence Data
>SC201898 3' UTR clone of NM_001008699
The sequence shown below is from the reference sequence of NM_001008699. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCACCAAGTGGCACAACTCAAATATTTGCTGAGTTCCTCCTACATGGCTAGCCCTGTGCTAGACACTGG
GGAATCGGCGATGAACAAAGCAGATAGAAATCCCCACTCTTGTGGAGCTGACATTCTGGAGGGAGAGACA
AAAAGCAAACATATAAAGAAAGAAAGAAATCACATGGATCTGGATGACAGTGAGTGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001008699.1
Synonyms CD124; IL4RA
Summary This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Locus ID 3566
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...