Ribonuclease 3 (RNASE3) (NM_002935) Human 3' UTR Clone

CAT#: SC201896

3' UTR clone of ribonuclease RNase A family 3 (eosinophil cationic protein) (RNASE3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Ribonuclease 3 (RNASE3) (NM_002935) Human 3' UTR Clone
Vector pMirTarget
Synonyms ECP; RAF1; RNS3
ACCN NM_002935
Insert Size 198 bp
Sequence Data
>SC201896 3' UTR clone of NM_002935
The sequence shown below is from the reference sequence of NM_002935. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACGGTATCCTGTGGTTCCAGTTCACCTGGATACCACCATCTAAGCTCCTGTATCAGCAGTCCTCATCATC
ACTCATCTGCCAAGCTCCTCAATCATAGCCAAGATCCCATCCCTCCATGTACTCTGGGTATCAGCAACTG
TCCTCATCAGTCTCCATACCCCTTCAGCTTTCCTGAGCTGAAGTCCCTTGTGAACCCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002935.2
Synonyms ECP; RAF1; RNS3
Summary The protein encoded by this gene belongs to the pancreatic ribonuclease family, a subset of the ribonuclease A superfamily. The protein exhibits antimicrobial activity against pathogenic bacteria [provided by RefSeq, Oct 2014]
Locus ID 6037
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...